This is the COVID-19 Report for Monday, August 31, 2020
The first section deals with Macon County and an additional section is a collection of videos on the pandemic and issues related to the pandemic.
---BEGIN SPONSOR SEGMENT---
Carrion Tree Service is underwriting Macon Media for today. they are a fully licensed and insured tree service, specializing in dangerous tree removal, view clearing, pruning, and crane services with a 24 Hour emergency response.
Their phone number is 371-4718.
They can handle all your tree removal needs in good or bad weather.
---END DAY SPONSOR SEGMENT---
Macon County Updates
Numbers from Macon County Public Health
Cases
547 Detected Cases (+1 since Friday)
15 Active Positive (-15 since Friday)
525 Recovered (+13 since Friday)
7 Deaths (+3 since Friday)
Testing Data for Macon County
5038 MCPH Tests (+37 since Friday)
1755 Tests by Others (+5 since Friday)
6793 Total Tests (+42 since Friday)
111 Tests Pending Results (-22 since Friday)
3:03pm
Press Release
Macon County Public Health
Monday, August 31, 2020
Macon County Reports Three Deaths Related to COVID-19
Three Macon County residents diagnosed with COVID-19 have died. These individuals were over the age of 65 and had underlying health conditions. To protect the families´ privacy, no further information will be released about these patients.
“We are extremely saddened by these losses. As this pandemic is affecting our entire community, today we pray for these families coping with this devastating news.” stated Kathy McGaha, Macon County Health Director. Mrs. McGaha continued, “It is so important that each of us do what we can to limit the spread of this virus. We can make a difference by wearing a mask, washing your hands, and staying 6 feet from others. Continue to practice social distancing and limit your trips outside your home to help to slow the spread of COVID-19.”
The entire state of North Carolina is under a “Safer at Home” executive order, currently under phase two with masks required to be worn when social distancing cannot be maintained. Older adults and people of any age who have serious underlying medical conditions might be at higher risk for severe illness from COVID-19; however, anyone of any age can become infected with this illness. Therefore, we ask that community members strictly follow the governor’s orders and continue to practice social distancing, as well as safe hygiene measures such as hand washing and frequently cleaning touched objects and surfaces. The public can monitor the different phases of re-opening and learn more about the restrictions at https://covid19.ncdhhs.gov/guidance.
It is important to make sure the information you are getting about COVID-19 is coming directly from reliable sources. For more information, please visit the CDC’s website at www.cdc.gov/coronavirus and NCDHHS’ website at www.ncdhhs.gov/coronavirus, which also includes future positive COVID-19 test results in North Carolina.
Symptoms for COVID-19 are fever, cough, other lower respiratory illness (shortness of breath). If you believe that you may have COVID-19, please call the Health Department at 828-349-2517. The call center is open Monday through Friday from 8:30am – 4:00pm, closing daily for lunch from 12:00pm – 1:00pm, until further notice.
The Bermuda High building into the area will largely limit afternoon to evening thunderstorms by mid-week and produce seasonably hot conditions that will last through the end of the week. Unsettled and cooler weather may return by this weekend.
---BEGIN DAY SPONSOR---
Carrion Tree Service is underwriting Macon Media for today. they are a fully licensed and insured tree service, specializing in dangerous tree removal, view clearing, pruning, and crane services with a 24 Hour emergency response.
Their phone number is 371-4718.
They can handle all your tree removal needs in good or bad weather.
---END DAY SPONSOR---
Macon Calendar
Macon County Cooperative Extension, Christy Bredenkamp will be hosting a Ginseng Workshop in September
The N.C. Cooperative Extension Service is offering a free seminar on Ginseng Production for homeowners who desire to grow “sang.” This program will be held on Thursday September 3 rd from 6:00 – 8:00 p.m. online via Zoom.
Topics covered will be: state regulations for growing and hunting “sang”, plant physiology, present and historical use of ginseng and comparing Asian versus American ginseng. Major time and emphasis of the program will be dedicated to the woods simulated cultural practices such as: site selection and preparation, sowing, harvesting, drying the roots and seed stratification.
For more information contact the Macon County Extension Center at 828 349 2046 or e-mail Christy Bredenkamp at clbreden@ncsu.edu
NewsBrief
Decorative Lamp Posts to be Painted Today Duke Energy will be painting the decorative lamp posts on Main Street today. Parking spaces will be blocked off to allow crews space to reach the lamp posts during the day, so parking will be limited.
Cowee Firefighter Laid to Rest
Charlie Greenwood, a firefighter and founding member of the Cowee Fire/Rescue Honor Guard, was laid to rest in the cemetery of Cowee Baptist Church on Sunday. Below is a short tribute video showing the funeral procession passing under a flag held aloft by two ladder trucks.
Save Our Children Event
An event "to bring awareness to child trafficking and to save our children from being groomed, harmed and abducted by the evil in this world" was held Sunday afternoon in a field beside Franklin First Baptist Church. The event featured bands and speakers. Organizers hope to make this an annual event. Macon Media streamed the event live on Facebook and recorded additional video that will be published sometime Tuesday or Wednesday.
A chance of showers, then showers and thunderstorms likely after 10am. Patchy fog before 9am. Otherwise, mostly cloudy, with a high near 80. Calm wind becoming southwest around 5 mph in the afternoon. Chance of precipitation is 70%. New rainfall amounts between a quarter and half of an inch possible.
Tonight
Showers and thunderstorms likely before 1am, then a slight chance of showers between 1am and 4am. Patchy fog after midnight. Otherwise, mostly cloudy, with a low around 67. Calm wind. Chance of precipitation is 60%. New precipitation amounts of less than a tenth of an inch, except higher amounts possible in thunderstorms.
Tuesday
A chance of showers, with thunderstorms also possible after 4pm. Patchy fog before 9am. Otherwise, partly sunny, with a high near 85. Calm wind becoming west southwest around 5 mph in the afternoon. Chance of precipitation is 50%.
Tuesday Night
A slight chance of showers and thunderstorms before 9pm, then a slight chance of showers between 9pm and 10pm. Mostly cloudy, with a low around 68. Calm wind. Chance of precipitation is 20%.
Wednesday
A 30 percent chance of showers and thunderstorms, mainly after 5pm. Partly sunny, with a high near 85.
Wednesday Night
Partly cloudy, with a low around 68.
Hazards
Scattered to numerous thunderstorms can be expected today. A few storms may become severe, producing damaging winds, frequent lightning, and locally heavy rainfall.
Air Quality
Macon County, including the ridgetops, will be in the upper range of green today.
---BEGIN SPONSOR SEGMENT ---
Weather Sponsor
Adams Products, a Division of Oldcastle is underwriting the daily weather briefing & public safety updates for the month.
Open 7:30 AM to 4:00 PM, M-F, located at 895 Hickory Knoll Road, Franklin, NC. Visit our Facebook page at:
https://www.facebook.com/Adams.Oldcastle.Franklin.NC/
All your masonry needs are available. Our phone number is 828.524.8545, the public is welcome, we’ll help you with your next project.
---END SPONSOR SEGMENT---
Tropical Weather
(The Atlantic hurricane season runs from June 1st through November 30th)
Tropical Weather Outlook
NWS National Hurricane Center Miami FL
200 AM EDT Mon Aug 31 2020
For the North Atlantic...Caribbean Sea and the Gulf of Mexico:
1. Recent satellite imagery and satellite-derived wind data indicate that a broad area of low pressure associated with a tropical wave over the eastern Caribbean Sea has changed little in organization since yesterday. However, environmental conditions are expected to gradually become more conducive for development, and a tropical depression is likely to form during the next couple of days while the system moves moves westward at at 15 to 20 mph. Interests in Jamaica, Honduras, Belize, Guatemala and the Yucatan peninsula should monitor the progress of this disturbance.
* Formation chance through 48 hours...high...70 percent.
* Formation chance through 5 days...high...80 percent.
2. An area of low pressure is located a few hundred miles east of Jacksonville, Florida. This system has gradually gotten better organized during the past 24 hours but is currently producing only limited showers and thunderstorms. Additional development is expected and a tropical depression is likely to form by the middle of the week while the system moves northeastward or east-northeastward, initially parallel to the southeastern coast of the U.S. and then away from land. Upper-level winds are expected to become less conducive for further development on Wednesday.
* Formation chance through 48 hours...medium...60 percent.
* Formation chance through 5 days...high...70 percent.
3. A tropical wave is expected to emerge off the coast of Africa in a couple of days. Gradual development of this system will be possible through the end of the week while it moves slowly westward over the far eastern tropical Atlantic Ocean.
* Formation chance through 48 hours...low...near 0 percent.
* Formation chance through 5 days...low...30 percent.
4. Another tropical wave is located over the eastern Atlantic Ocean, several hundred miles southwest of the Cabo Verde Islands. This system is producing little shower activity, and any development of this system should be slow to occur as it moves slowly westward.
* Formation chance through 48 hours...low...near 0 percent.
* Formation chance through 5 days...low...10 percent.
End Daily Weather Segment
Begin COVID-19 Update
Here is a brief morning update on the latest COVID-19 numbers from the various government agencies and private sources. Amore detailed update from Thursday is available. [LINK] https://thunderpigblog.blogspot.com/2020/08/covid-19-update-for-thursdayaugust.html
Centers forDisease Control [LINK] https://covid.cdc.gov/covid-data-tracker/
165,076 Detected Cases
11,435 Detected in the Last 7 Days
1,590 Detected Cases per 100,000 population
25 Reported Deaths per 100,000 population
2,683 ReportedDeaths
NC Dept of Health and Human Svcs [LINK] http://covid19.ncdhhs.gov/
166,127 Detected Cases out of 2,293,273 tests
2,692 Reported Deaths
917 Reported Current Hospitalizations
Resources for Reliable Information about the Corona Virus (COVID-19) [LINK]
CROWDFUNDING OR DAY SPONSORSHIP OPPORTUNITIES
If you receive value from what Macon Media provides to the community, please consider becoming a supporter and contribute at least a dollar a month. Those who support Macon Media with at least a dollar a month receive early access to video of some events and meetings before they are made public on the website. Videos and news involving public safety are not subject to early access.
Here is an update for this afternoon on how humanity is dealing with the COVID-19 Pandemic that is caused by SARS CoV-2. The story is told through links to news outlets, research papers, and videos. They are presented without comment.
Data from Macon County Public Health as of this afternoon and graph by Macon Media of data from May 30th to August 28th [LINK]
Please note there is a gap for Saturdays and Sundays since the health department will no longer be reporting numbers on those days.
546 Detected Cases (+7 in one day)
30 Active Positive (-2 in one day)
512 Recovered (+9 in one day)
4 Death (unchanged)
Testing Data for Macon County
5001 MCPH Tests (+68 in one day)
1755 Tests by Others (unchanged)
6756 Total Tests (+68 in one day)
143 Tests Pending Results (+53 in one day)
Macon County Schools Update
Schools started back on Monday, August 17th with most children attending school twice a week for in-person instruction. High School students will attend one day a week, with an opportunity for extra instruction on Fridays.
As of today, Friday, August 28th, the number of positive COVID-19 cases have stabilized throughout our school system. Therefore, Macon County Schools, in partnership with the Macon County Public Health Department, have made the decision to continue our current course of action in serving our students. Macon Early College, Highlands School, Nantahala School, and all K-4 schools in the Franklin area will continue with their current plan. Franklin High School, Mountain View Intermediate School, Macon Middle School and Union Academy will remain in remote learning as announced earlier this week. As planned, September 7-11, 2020 will be a remote learning week for all schools (with the exception of Monday, September 7th which is the Labor Day Holiday). Additional details and updates will be released as we move forward. We ask that the community join us in adhering to the social distancing protocols as well as the 3 W’s- Wear, Wait & Wash- so that all students may return to school soon.
PRESS RELEASE
Macon County Schools
12:21pm
Today, we were notified that a staff member at Iotla Valley Elementary School has tested positive for COVID-19. This individual is currently under quarantine. Contact tracing is currently underway through the Macon County Health Department. Any student or staff member identified through the contact tracing will be notified. Macon County Schools will continue to work closely with the Macon County Health Department as we monitor this situation.
North Carolina Coronavirus Map and Case Count [LINK]
Information Warfare on United States’ Citizens: How China Weaponized COVID-19 [LINK]
Washington University develops COVID-19 saliva test Test is faster, simpler than nasal, oral swab tests and enables screening on a massive scale [LINK]
A New Era of Coronavirus Testing Is About to Begin [LINK]
J&J to start mid-stage coronavirus vaccine trials in three European countries [LINK]
7 Signs You May Have Had COVID-19 Without Realizing It, According to Doctors [LINK]
Antiviral drug used to treat coronavirus infection in cats may be effective against SARS-CoV-2, says study [LINK]
Another COVID-19 reinfection: This time second infection was more severe [LINK]
New iOS 13.7 Update Features COVID-19 Exposure Notifications (without a Separate App) [LINK]
Former top Pentagon strategist calculates how badly the US has performed on COVID compared to the other G20 nations: 126,000 excess deaths and counting [LINK]
Millions of Americans could lose their electricity as COVID-19 shutoff moratoriums expire [LINK]
Messaging about Covid-19 has changed too much and too often, quickly evolving from “flatten the curve” to something very different, so Americans aren't listening [LINK]
Nearly every California GOP state senator in quarantine after coronavirus exposure. [LINK]
'I had to plan my funeral': Bodybuilder nurse battles long-term complications from COVID-19 [LINK]
Foster Farms Ordered to Shut Down COVID-19-Stricken Central Valley Poultry Plant | KQED [LINK]
Two P.R. experts at the F.D.A. have been removed after the fiasco over convalescent plasma. [LINK]
Texas coronavirus cases fall, along with testing numbers [LINK]
New Iowa COVID-19 Cases Jump Past 2,500 & 12 More Deaths Reported [LINK]
Texas Bars Can Reopen If They Sell Food From Food Trucks or Vendors [LINK]
3,815 new Florida coronavirus cases reported Friday; 89 new deaths [LINK]
The police say no to the new public proposal (Sweden) The police say no to the proposal to allow larger audiences at certain events. The authority points out that resources are lacking to ensure that the rules are followed. [SWEDISH]
Kentucky man faces $750,000 fine, possible jail time for violating Canada's Quarantine Act [LINK]
Merkel says pandemic to worsen, to focus on social cohesion, economy [LINK]
Coronavirus? This 24 y/o women with kidney disease broke quarantine so she can go on vacation. [GREEK]
Greece bans flights from Barcelona, extends COVID-19 travel restrictions [LINK]
Coronavirus: in Italy 1,462 more cases, 9 more dead [LINK]
Coronavirus cases continue to level off in England [LINK]
Isle of Man goes 100 days without a new case of COVID-19 [LINK]
Only ten days of isolation for patients with COVID-19 in Quebec [LINK]
Coronavirus cases in Latin America pass 7 million [LINK]
If you receive value from what Macon Media provides to the community, please consider becoming a supporter and contribute at least a dollar a month. Those who support Macon Media with at least a dollar a month receive early access to video of some events and meetings before they are made public on the website. Videos and news involving public safety are not subject to early access.
An upper-level ridge axis will move overhead today as Tropical Depression Laura gets picked up by the westerlies and takes a turn to the east. The remnants of Laura are expected to pass just to our north early Saturday with gusty winds at high elevations and increased rain chances across the region Friday night through Saturday. Drier high pressure will build on Sunday, but that will be short-lived, as moisture returns on Monday.
Macon Calendar
1st Annual Radical Love Lobster Fest [EVENT PAGE]
SATURDAY AT 12 PM – 4 PM
What better way to celebrate Stephanie's 50th birthday than with a New England lobster dinner! Come help us raise money to support Smoky Mountain Harm Reduction and the free services we provide!
Place your order before Wednesday 8/26 at 5 pm and we'll fly your lobster in fresh from Gloucester, MA! On Saturday, you can either pick up your lobster steamed with an ear of corn and a potato or cook it at home yourself. Your choice!
All proceeds will go to provide life-saving services to our most vulnerable folx in WNC. Questions? Call Stephanie at 617-828-9184.
Thanks for everyone's continued support as we work to together to keep our most vulnerable folx alive and healthy.
Macon County Cooperative Extension, Christy Bredenkamp will be hosting a Ginseng Workshop in September
The N.C. Cooperative Extension Service is offering a free seminar on Ginseng Production for homeowners who desire to grow “sang.” This program will be held on Thursday September 3 rd from 6:00 – 8:00 p.m. online via Zoom.
Topics covered will be: state regulations for growing and hunting “sang”, plant physiology, present and historical use of ginseng and comparing Asian versus American ginseng. Major time and emphasis of the program will be dedicated to the woods simulated cultural practices such as: site selection and preparation, sowing, harvesting, drying the roots and seed stratification.
For more information contact the Macon County Extension Center at 828 349 2046 or e-mail Christy
Bredenkamp at clbreden@ncsu.edu
NEWS BRIEF Duke Energy will be painting the decorative lampposts on Main Street next week.
They will be starting Monday, August 31, 2020. The Franklin Police Department has agreed to block off parking along Main Street during the time Duke Energy will be painting. [LINK]
General Forecast Through Sunday Night
Today
Patchy fog in the morning. A 50 percent chance of showers and thunderstorms, mainly after 11am. Otherwise, mostly cloudy, with highs ranging from the mid-70s in the higher elevations to the mid-80s in the lower elevations. Calm winds in the morning increasing to come out of the southwest around 5 mph in the afternoon. New rainfall amounts between a tenth and quarter of an inch, except higher amounts possible in thunderstorms.
Tonight
Showers and thunderstorms likely before midnight, then showers likely and possibly a thunderstorm after midnight. Patchy fog after 10pm. Otherwise, cloudy, with lows in the 60s. Winds out of the south around 5 mph. Chance of precipitation is 70%. New rainfall amounts between a quarter and half of an inch possible.
Saturday
Showers and possibly a thunderstorm, mainly before 5pm, then showers and thunderstorms likely after 5pm. Highs ranging from the lower 70s in the higher elevations to the lower 80s in the lower elevations. Winds out of the southwest 5 to 10 mph early increasing and shifting to come out of the northwest 10 to 15 mph by midmorning. Winds could gust as high as 25 mph in the lower elevations and 35 mph in the higher elevations. Chance of precipitation is 90%. New rainfall amounts between a quarter and half of an inch possible.
Saturday Night
Showers likely and possibly a thunderstorm before 7pm, then a chance of showers and thunderstorms between 7pm and 2am, then a slight chance of showers after 2am. Mostly cloudy, with lows in the 60s. Winds out of the northwest 5 to 10 mph in the lower elevations and 10 to 15moh in the higher elevations becoming calm by dawn. Chance of precipitation is 60%.
Sunday
A 20 percent chance of showers after 2pm. Mostly sunny, with highs ranging from the mid-70s in the higher elevations to the mid-80s in the lower elevations.
Sunday Night
Mostly cloudy, with lows in the 60s.
Hazards
Tropical Storm Laura has weakened to a Tropical Depression over the Mississippi River Valley. The system will then track east through the central Appalachians to our north tonight and through the Mid-Atlantic region on Saturday. Western North Carolina will likely experience heavy rain and strong wind gusts beginning Friday night and lingering into Saturday morning. Damaging winds, and possibly even isolated tornadoes, are possible from thunderstorms Saturday as the post-tropical system passes north of the area.
Continue to monitor the latest forecast for any updates.
Air Quality
Macon County, including the ridgetops, will be in the upper range of green today.
---BEGIN SPONSOR SEGMENT ---
Weather Sponsor
Adams Products, a Division of Oldcastle is underwriting the daily weather briefing & public safety updates for the month.
Open 7:30 AM to 4:00 PM, M-F, located at 895 Hickory Knoll Road, Franklin, NC. Visit our Facebook page at:
https://www.facebook.com/Adams.Oldcastle.Franklin.NC/
All your masonry needs are available. Our phone number is 828.524.8545, the public is welcome, we’ll help you with your next project.
---END SPONSOR SEGMENT---
Tropical Weather
(The Atlantic hurricane season runs from June 1st through November 30th)
Tropical Weather Outlook
NWS National Hurricane Center Miami FL
200 AM EDT Fri Aug 28 2020
For the North Atlantic...Caribbean Sea and the Gulf of Mexico:
The National Hurricane Center has issued the last advisory on Tropical Depression Laura, centered inland over Arkansas.
Future advisories will be issued by the Weather Prediction Center.
1. A tropical wave located about 1000 miles east of the Windward Islands is producing an area of showers and thunderstorms.
Some gradual development of this system is possible during the next several days while it moves westward at about 15 mph toward the eastern Caribbean islands.
* Formation chance through 48 hours...low...20 percent.
* Formation chance through 5 days...low...30 percent.
2. Another tropical wave is located over the eastern Atlantic Ocean just west of the Cabo Verde Islands. The northern part of this wave, which should move rapidly westward over the central Atlantic during the next few days, is not forecast to develop as it is expected to remain in unfavorable environmental conditions.
However, the southern part of the wave is expected be nearly stationary south of the Cabo Verde Islands for the next several days, and some development of this system is possible early next week when it begins to move slowly westward over the eastern and central tropical Atlantic.
* Formation chance through 48 hours...low...near 0 percent.
* Formation chance through 5 days...low...30 percent.
Tropical Depression Laura
Tropical Depression Laura Discussion Number 33
NWS National Hurricane Center Miami FL AL132020
1000 PM CDT Thu Aug 27 2020
Laura has continued to spin down after being over land for nearly a day. Surface observations no longer support tropical storm intensity, and therefore the system is being downgraded to a tropical depression. The cyclone should become a post-tropical low within a couple of days, and then transform into an extratropical cyclone while moving off the U.S. east coast.
The official forecast shows some restrengthening in 2-4 days due to baroclinic processes. However, by the end of the forecast period, the system should be absorbed by a larger extratropical cyclone to the east of the Canadian Maritimes.
Laura continues to move north-northeastward or at about 015/13 kt. A turn toward the northeast and east-northeast with increasing forward speed is likely while the cyclone becomes embedded in the stronger westerly flow. The official track forecast follows the latest dynamical model consensus.
There is a continued threat of flooding from Laura for the next couple of days. This is the last NHC advisory on Laura.
Future information on this system, including the rainfall threat, can be found in Public Advisories issued by the Weather Prediction Center beginning at 4 AM CDT, under AWIPS header TCPAT3, WMO header WTNT33 KWNH, and on the web at http://www.wpc.ncep.noaa.gov
Key Messages:
1. Additional rainfall will continue to lead to flash flooding along small streams, urban areas, roadways, and minor to moderate river flooding across portions of Louisiana, Mississippi and Arkansas. The heavy rainfall threat and flash and urban flooding potential will spread northeastward into the middle-Mississippi, lower Ohio and Tennessee Valleys, and Mid-Atlantic States Friday and Saturday.
2. A few tornadoes remain possible this evening across eastern Arkansas, western Tennessee, northern Mississippi, and the Missouri Bootheel. The risk for a few tornadoes is expected to redevelop Friday afternoon into the evening across parts of the Mid-South and Tennessee Valley regions.
Here is a brief morning update on the latest COVID-19 numbers from the various government agencies and private sources. Amore detailed update from Thursday is available. [LINK]
Resources for Reliable Information about the Corona Virus (COVID-19) [LINK]
CROWDFUNDING OR DAY SPONSORSHIP OPPORTUNITIES
If you receive value from what Macon Media provides to the community, please consider becoming a supporter and contribute at least a dollar a month. Those who support Macon Media with at least a dollar a month receive early access to video of some events and meetings before they are made public on the website. Videos and news involving public safety are not subject to early access.
Here is an update for this afternoon on how humanity is dealing with the COVID-19 Pandemic that is caused by SARS CoV-2. The story is told through links to news outlets, research papers, and videos. They are presented without comment.
Education Employees Compensation (support those excluded in Long Session)
•Teachers and Principals - $2,000 Bonus will add $230,000,000 to the budget
•Noncertified Public School Employees - $1,000 bonus wll add $50,000,000 to the budget
•UNC System and Community Colleges Employees - $1,500 bonus wll add 80,000,000 to the budget
•Subtotal the above changes will add $360,000,000 to the budget
How Does COVID-19 Testing Actually Work?
From the video description:
Sars-Cov-2, the virus that causes Covid-19 is easily the most defining feature of 2020. In the last 8 months the world has changed radically and there have been plenty of fumbles as countries struggle to deal with the chaos. One of the most important issues has been testing for the virus. In this video, I aim to demystify how that testing actually works down to the chemical level and show exactly how it's done. We'll be covering the viruses anatomy, as well as three types of test: PCR, LAMP and Antibody.
Antibody test: https://bit.ly/2CIXT0S Right after this video went up, one of my awesome friends Sebastian designed new primers which are much much better than the CDC or other primers used in this video. Here are their sequences for those interested and if you'd like, check out Sebastian's work here: http://binomicalabs.org/ SpikeF - AGGAATTTTTATGAACCACAAATCA
MembraneR - CGGTGATCCAATTTATTCTGTAAAC
NucleoF - AAATGAAAGATCTCAGTCCAAGATG
NucleoR - ACAGTTTGCTGTTTCTTCTGTCTCT
Oxford trials start in Pune, 2 volunteers get their first shots of COVID-19 vaccine candidate [LINK]
Abbott Cleared for Fast $5 Covid Test That Avoids Lab Delay [LINK]
Abbott'S Fast, $5, 15-Minute, Easy-to-Use Covid-19 Antigen Test Receives Fda Emergency Use Authorization; Mobile App Displays Test Results to Help Our Return to Daily Life; Ramping Production to 50 Million Tests a Month (press release) [LINK]
Test kit finds coronavirus on surfaces in West Michigan [LINK]
Blood clots: A major problem in severe Covid-19 [LINK]
Women may mount stronger COVID-19 immune response: Study [LINK]
6 feet may not always be enough distance to protect from COVID-19 [LINK]
Woman may have caught coronavirus in airplane toilet, researchers say [LINK]
Psychologist suggests negative impact of pandemic on friendships likely to be fleeting [LINK]
Number of people with coronavirus hospitalized in North Alabama continues to decrease [LINK]
COVID-19 could permanently increase the amount of illness the health care system handles. [LINK]
Fauci says he was in surgery when task force discussed CDC testing guidelines [LINK]
Messaging about Covid-19 has changed too much and too often, quickly evolving from “flatten the curve” to something very different, so Americans aren't listening [LINK]
CDC was pressured 'from the top down' to change coronavirus testing guidance, official says - ABC17NEWS [LINK]
NY will not be following new CDC testing guidance [LINK]
Experts Alarmed as CDC Abruptly Changes COVID-19 Advice Amid Reports of Interference [LINK]
COVID-19 cases among children surge in Georgia [LINK]
UGA worker dies from COVID-19, family said she was scared to work on campus (Georgia) [LINK]
Covid Gag Rules at U.S. Companies Are Putting Everyone at Risk [LINK]
‘You can’t get close, yet you can’t stay away’: Latino cultural beliefs clash with pandemic safety [LINK]
Governor Gavin Newsom Announces Massive 150% Increase In COVID-19 Testing, Foresees Possibility of Reopening Schools, Business [LINK]
California coronavirus testing to double capacity and speed up results [LINK]
L.A. County reports cases of newborns with COVID-19 for first time [LINK]
If you receive value from what Macon Media provides to the community, please consider becoming a supporter and contribute at least a dollar a month. Those who support Macon Media with at least a dollar a month receive early access to video of some events and meetings before they are made public on the website. Videos and news involving public safety are not subject to early access.
To submit releases for publication, email me here. This includes Guest Commentaries. If you have a photo that you wish me to use with your press release or article, please send it to me, otherwise I'll use whatever I feel best fits your article.
Letters to the Editor
Send Letters to the Editor to editor@MaconMedia. Limit is one submission every seven days. You may include photos, video or audio. Submissions will be edited for vulgarity or similar reasons. Limit submissions to less than 10,000 words. LOL
For a quicker response, send me a message on Twitter or add me to a circle on Google Plus and send it just to me.
If you have been sending me press releases via my private email address, that will continue to work just fine. The Twitter or Google+ account will get my attention quicker.
NON PROFIT OR CIVIC EVENTS
Macon Media will promote nonprofit or civic events if contacted by an organizer of the event. This includes rallies, protests, community forums, and parades. Messeanger Link http://m.me/MaconMediaNews
If you're of a mind, and can afford it, a dollar a month (or more) from enough people will make a huge difference in improving the quality of coverage of local meetings and events, as well as allowing remote weather stations and weather cams to be deployed throughout the county that you will be able to access online.
Currently, 20 people have pledged $99 a month. This is a tremendous help. Please visit www.patreon.com/MaconMedia for more information on how to contribute.
Businesses can underwrite this coverage by day sponsorships, surplus equipment donations, etc. Inquire at editor@maconmedia.com for more information.
Donations accepted for the purpose of supporting this blog and activities related to improving it's operations and my coverage of local festivals and local government meetings.
Posts
